Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
circRNA-018127 | |||
Gene | Ipo11 | Organism | Mouse |
Genome Locus | n/a | Build | n/a |
Disease | Polarized macrophages | ICD-10 | n/a (n/a) |
DBLink | Link to database | PMID | 28075448 |
Experimental Method | |||
Sample Type | Tissues | Comparison | Bone Marrow Derived Macrophages (BMDMs) cultured with and without Macrophage polarization using Lipopolysaccharide |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward AAGACGCTGGCATCCAAACCTCGGCTGGCTTCAACA Reversen/a | Statistics | Fold Change : Downregulated pvalue : p<0.05 |
Citation | |||
Zhang, Y, Zhang, Y, Li, X, Zhang, M, Lv, K (2017). Microarray analysis of circular RNA expression patterns in polarized macrophages. Int. J. Mol. Med., 39, 2:373-379. |